les endocardite

استعرض الموضوع السابق استعرض الموضوع التالي اذهب الى الأسفل

les endocardite

مُساهمة من طرف mohamed hamdane في الخميس 29 ديسمبر 2011 - 3:32

Introduction

Endocardite , hémocultures , valves, sérologies , histopathologie, PCR

L'endocardite infectieuse (EI) est une maladie spontanément mortelle. L'identification du germe responsable de l'infection est essentiel pour guider le traitement . Parfois le recours à la chirurgie cardiaque avec remplacement des valves s'avère nécessaire.

2. Qu'est ce que le syndrome ?

L'endocardite infectieuse est la localisation et la prolifération au niveau de l'endocarde de germes véhiculés par le sang. Il s'agit d'une atteinte infectieuse qui va causer des dégâts essentiellement valvulaires, dominée par les risques d'insuffisance cardiaque et d'embolies d'origine cardiaque.

3. Quelle est sa fréquence ?

Les endocardites infectieuses (EI) sont des maladies rares mais non exceptionnelles . Le taux annuel d'incidence en France est de 31 cas pour 1 million d'habitant . L'EI doit être considérée comme une maladie infectieuse avec un haut taux de morbidité et de mortalité (6 à 23% selon le germe) . 5 à 15% demeurent sans cause identifiable selon les régions et les méthodes diagnostiques employées.

Références :

Changing profile of infective endocarditis: results of a 1-year survey in France. Hoen B, Alla F, Selton-Suty C, Beguinot I, Bouvet A, Briancon S, Casalta JP, Danchin N, Delahaye F, Etienne J, Le Moing V, Leport C, Mainardi JL, Ruimy R, Vandenesch F; Association pour l'Etude et la Prevention de l'Endocardite Infectieuse (AEPEI) Study Group. JAMA. 2002 Jul 3;288(1):75-81.
Bacterial zoonoses and infective endocarditis, Algeria. Benslimani A, Fenollar F, Raoult D. Emerg Infect Dis. 2005 Feb;11(2):216-24.
4. Quels en sont les causes et les facteurs de risque ?

Les portes d'entrée :

La bactérie peut être une bactérie banale de l'homme présente sur les muqueuses :
Stomatologique( mauvais état dentaire, soins sur le parodonte)
ORL
Digestive (Polypes ou cancers coliques sont alors des éléments favorisants)
Les infections urinaires, les infections cutanées et les interventions médicales (manœuvres instrumentales, chirurgie, pace maker), la toxicomanie intraveineuse.
Les zoonoses sont de source animale ( Bartonellose, fièvre Q, brucellose )
Les maladies valvulaires :

à haut risque :
prothèse valvulaire
antécédent d'endocardite
cardiopathies congénitales cyanogènes
shunts chirurgicaux
à risque moyen :
autres cardiopathies congénitales
valvulopathies acquises
cardiomyopathie hypertrophique
prolapsus mitral avec fuite et / ou épaississement valvulaire
5. Quels sont les signes cliniques ?

Les signes d'appel sont très variés, allant des formes aiguës septicémiques, d'évolution brutale sur quelques jours à des formes très lentes évoluant sur plusieurs semaines. La fièvre est le symptôme majeur . Elle peut être associée à un amaigrissement et à une altération de l'état général. L'apparition ou la modification d'un souffle cardiaque est le 2ème signe majeur de l'endocardite. La splénomégalie est présente dans 20 à 40% des cas, elle est observée dans les formes chroniques. Les signes cutanéo-muqueux sont inconstants mais ont une grande valeur diagnostique : faux panaris d'Osler, placard érythémateux de Janeway (1), hippocratisme digital (2), purpura pétéchial aussi observé au niveau oculaire (purpura conjonctival , taches de Roth (3)) . Le diagnostic d'endocardite doit être évoqué devant la présence d'une spondylodiscite, d'arthralgies ou de lombalgies. Fréquemment, les symptômes d'appel sont trompeurs : fièvre absente ou masquée par une antibiothérapie inadaptée, complication embolique révélatrice, notamment cérébrale , tableau d'infection bronchique traînante dans les endocardites sur sonde de pacemaker.

1

2

3

6. Quels sont les microorganismes pouvant être responsables du syndrome ?

Les streptocoques oraux sont en cause dans 25% des cas, les streptocoques d'origine digestive dans 20%. S. bovis est devenu plus fréquent que les entérocoques. . Les streptocoques déficients, à croissance difficile, et les s. bêta-hémolytiques sont plus rares. Le pneumocoque est toujours responsable d'endocardites aiguës très mutilantes.
Les staphylocoques (15 à 30 % des cas). Il s'agit le plus souvent du staphylocoque aureus. Les staphylocoques à coagulase négative essentiellement le S. epidermidis sont retrouvés dans les endocardites précoces après chirurgie cardiaque et chez les toxicomanes utilisant la voie intraveineuse.
Les bactéries à développement intracellulaire (agents de zoonoses): Bartonella quintana, B. henselae et Coxiella burnetii (environ 5% des cas). Les hémocultures sont négatives et le diagnostic est porté par la sérologie ou la culture cellulaire du sang ou des valves.
Les bactéries du groupe HACEK (Haemophilus, Actinobacillus, Cardiobacterium hominis, Eikenella, Kingella kingae) sont impliquées dans 3% des EI.
Autres germes : entérobactéries, Brucella...
Les endocardites à champignon, principalement à Aspergillus et Candida représentent 0.5 à 1% des cas. Ils sont en cause dans les EI sur prothèses, chez les toxicomanesutilisant la voie intraveineuse, après antibiothérapie prolongée ou chirurgie cardiaque.
Endocardites à hémocultures négatives : ( 7 à 10%)Il s'agit le plus souvent d'endocardites infectieuses à hémoculturesnégativées par une antibiothérapie préalable intempestive .
Nombre de cas d' EI à hémocultures négatives : 88 of 620 cas (14%) - France (B. Hoen, CID, 1995) 116 of 487 cas (24%) - Suéde (M. Werner, Medecine, 2003) 120 of 817 cas (15%) - Japon (S. Nakatami, Circ J., 2003) 63 of 516 cas ( 12%) - Londres/GB (Lamas, Heart, 2003) 20 of 107 cas (18.7%) - Espagne (Zamorano, J Heat Valve Dis, 2003) 60 of 291 cas (21%) - Marseille/France (D. Raoult , non publié)
Diagnostics retenus à partir d'une collection de 348 EI à hémocultures négatives (Pr Raoult-1983-2002 Marseille)



Reférences:

Causative organisms of infective endocarditis according to host status. Barrau K, Boulamery A, Imbert G, Casalta JP, Habib G, Messana T, Bonnet JL, Rubinstein E, Raoult D. Clin Microbiol Infect. 2004 Apr;10(4):302-8.
Endocarditis due to rare and fastidious bacteria. Brouqui P, Raoult D. Clin Microbiol Rev. 2001 Jan;14(1):177-207.
Diagnostic methods. Current best practices and guidelines for identification of difficult-to-culture pathogens in infective endocarditis. Houpikian P, Raoult D. Cardiol Clin. 2003 May;21(2):207-17. Review.
7. Comment fait-on le diagnostic non spécifique du syndrome ?

Devant la multiplicité des signes cliniques, des scores ont été établis.

Les critères de Duke modifiés par Li sont les plus utilisés :

Critères majeurs
Germe dans 2 hémocultures différentes dont la responsabilité est reconnue dans les EI Streptocoques viridans, S.bovis, Entérocoques, HACEK,S.aureus
Persistance d 'hémocultures positives à germe compatible avec une EI
ETO : végétation , abcès, nouvelle fuite paraprothétique
Apparition d'un souffle de fuite valvulaire
Culture ou Sérologie de Coxiella burnetii IgG phase 1>ou égale à 800
Critères mineurs
Cardiopathie à risque ou toxicomanie
Température > ou = 38°C
Manifestations vasculaires(embolie artérielle, anévrysme mycotique, infarctus pulmonaire, hémorragie conjonctivale , hémorragie cérébrale)
Manifestations immunologiques( glomérulonéphrite, nodule d'Osler, tache de Roth )
Hémocultures positives ne correspondant pas aux critères majeurs ou sérologie positive pour un responsable d'EI (Brucella, Bartonella, Legionella )
Abcès


Végétation


Score de Durack modifié par LI : sont considérées comme EI:

Certaines :
soit d'une histologie compatible ou d'une culture de la valve positive soit 2 critères majeurs
ou 1 critère majeur + 3 critères mineurs
ou 5 critères mineurs
Possibles :
1majeur + 1mineur ou 3 mineurs
Rejetées :
alternative diagnostique ou résolution des signes sous une antibiothérapie < 4 jours ou absence de lésion caractéristique d'EI lors de la chirurgie après une antibiothérapie < 4 jours.
Références :

Modification of the diagnostic criteria proposed by the Duke Endocarditis Service to permit improved diagnosis of Q fever endocarditis. Fournier PE, Casalta JP, Habib G, Messana T, Raoult D. Am J Med. 1996 Jun;100(6):629-33.
Durack DT, Lukes AS, Bright DK, and the Duke Endocarditis Service. New criteria for diagnosis of infective endocarditis: utilization of specific echocardiographic findings. Am J Med 1994 ; 96 : 200-
Proposed modifications to the Duke criteria for the diagnosis of infective endocarditis. Li JS, Sexton DJ, Mick N, Nettles R, Fowler VG Jr, Ryan T, Bashore T, Corey GR. Clin Infect Dis. 2000 Apr;30(4):633-8. Epub 2000 Apr 3.
8. Comment fait-on le diagnostic spécifique (étiologique) du syndrome ?

Notre stratégie repose sur la mise en place d'un kit diffusé dans les services cliniques et dans le traitement spécifique et systématique de toutes les valves cardiaques.

8.1. kit microbiologique :

Ce kit est prélevé par le service clinique dés l'admission du malade . Il est réalisé sur une durée de 4 heures à raison d'un prélèvement toutes les 2 heures (H0,H2,H3) . Un questionnaire est rempli (annexe 1)

Le kit est composé de 3 sets comprenant :

SET I : à H0
1 jeu d'hémoculture aero-anaerobie avec résine
1 tube sec : sérologies (Coxiella burnetii, Bartonella henselae et quintana, Mycoplasma pneumoniae, Chlamydiae pneumoniae , Legionella pneumophila et aspergillus), et facteur rhumatoide
1 tube hépariné (cultures cellulaires)
SET II : à H2
1 hémoculture anaerobie avec résine
SET III : à H4
1 hémoculture anaerobie avec résine
8.2. Les valves cardiaques :

les valves cardiaques , après exérèse chirurgicale, sont l'objet d'une analyse histologique systématique à la recherche d'une endocardite infectieuse. L'endocardite infectieuse se définit histologiquement par la présence d'au moins une des 3 lésions morphologiques majeures que sont un infiltrat inflammatoire dense riche en polynucléaires neutrophiles, une végétation (1)et la détection de microorganismes. Les microorganismes peuvent être visualisés sur coupes histologiques grâce à l'emploi de colorations histochimiques spéciales telles que les colorations de Giemsa, de PAS, de Grocott et de Gram mais aussi par l'emploi d'anticorps spécifiques (Immunohistochimie) (2). La sensibilité de l'histologie est de 63%.

1 végétation


2 Immunohistochimie


8.3. Etude de la spécificité de l'histologie des valves dans les EI (Lepidi .H) - Classification histologique

La PCR 16S réalisée sur les valves à une sensibilité de 61%. Elle apporte un diagnostic étiologique dans 38% des cas d'endocardites opérées à hémocultures et sérologies négatives. Un algorithme d'interprétation est nécessaire avant tout rendu de résultat . La culture bactériologique réalisée en systématique a une sa sensibilité faible (13%) .

Classification histologique

A. Présence de végétation, microorganismes, et ou d'inflammation avec principalement des polynucléaires. B. Inflammation non spécifique. C. Absence d'inflammation.

8.4. Primers utilisés dans l'étude réalisée par G.Greub et al

Bacteries Genes Noms Primers
Eubacterie rrs Trans3 CAGCAGCCGCGGTAATAC
1050r CACGAGCTGACGACA
fD1 AGAGTTTGATCCTGGCTCAG
rP2 ACGGCTACCTTGTTACGACTT
Staphylococcus spp. RpoB StphF AAACCIATACGGAATTGGTT
StphR GTTTCATGACTTGGGACGG
Streptococcus spp. RpoB StrpF AARYTIGGMCCTGAAGAAAT
StrpR TGIARTTTRTCATCAACCATGTG
Enterococcus spp. RpoB StrpF AARYTIGGMCCTGAAGAAAT
StrpR TGIARTTTRTCATCAACCATGTG
Streptococcus spp. SOD d1 CCITAYICITAYGAYGCIYTIGARCC
d2 ARRTARTAIGCRTGYTCCCAIACRTC
Enterococcus spp. SOD d1 CCITAYICITAYGAYGCIYTIGARCC
d2 ARRTARTAIGCRTGYTCCCAIACRTC
Enterobacteriaceae rpoB CM7 AACCAGTTCCGCGTTGGCCTGG
CM31b CCTGAACAACACGCTCGGA
Enterobacteriaceae fliC EcoH1 AATACCAACAGCCTCTCGCT
EcoH2 AGAGACAGAACCTGCTGC
Mycoplasma hominis ftsY MH1F GTGTTGTATCGACAACAG
MH1R GTGTTGTATCGACAA
Coxiella burnetii IS111 Trans3 CAACTGTGTGGAATTGATGA
Trans5 TTTACATGACGCAATAGCGC
Bartonella spp. ITS UR1 CTTCGTTTCTCTTTCTTCA
UR2 CTTCTCTTCACAATTTCAAT
Bartonella spp. Pap Pap1 CTTTAATGACGACTTCTGTT
Pap4 CCGAAATCTGAGTAACGGTA
Bartonella spp. rib 1 ZRib1F CGGATATCGGTTGTGTTGAA
ZRib1R CATCAATRTGACCAGAAACCA
rib 2 Zrib2F GCATCAATTGCGTGTTCA
Zrib2R CCCATTTCATCACCCAAT
Fungi 18S rRNA NS1 GTAGTCATATGCTTGTCTC
NS4 CTTCCGTCAATTCCTTTAAG
18S rRNA NS3 GCAAGTCTGGTGCCAGCAGCC
NS8 TCCGCAGGTTCACCTACGGA
ITS ITS1 TCCGTAGGTGAACCTGCGG
ITS2 GCTGCGTTCTTCATCGATGC

mohamed hamdane
مشرف قسم اللغة الفرنسية
مشرف قسم اللغة الفرنسية

الجنس : ذكر
عدد المساهمات : 1814
تاريخ الميلاد : 16/10/1990
الأختصاص : infirmier de la santé publique
تاريخ التسجيل : 19/04/2011
الأقامة : mostaganem
الأوسمة :

يسر ادارة منتديات "الشفاء" منحكم هذه الأوسمة تقديرا لجهودكم المبدولة لمساعدة الأخرين و تحسين مستوى المنتدى .

بارك الله فيكم


الرجوع الى أعلى الصفحة اذهب الى الأسفل

رد: les endocardite

مُساهمة من طرف aicha في الأربعاء 4 يناير 2012 - 7:04



[ندعوك للتسجيل في المنتدى أو التعريف بنفسك لمعاينة هذه الصورة]
إن مرت الأيام ولم ترون
فهذه رسالتي فتـذكرونـــــــي
وان غبت يوما ولم تجدون
ففي قلبي حب لكـم فـلاتنسونـــــــي
وان طال غيابـي عنكــــــــــــــم
دون عـودة اكون وقتهـا بحـاجــة
لدعـائكم فادعـوا لــــــــــــــــــــي


[ندعوك للتسجيل في المنتدى أو التعريف بنفسك لمعاينة هذه الصورة]

aicha
مشرفة
مشرفة

الجنس : انثى
عدد المساهمات : 1511
تاريخ الميلاد : 25/05/1989
الأختصاص : IDE
تاريخ التسجيل : 14/07/2011
الأقامة : ORAN
الأوسمة :

يسر ادارة منتديات "الشفاء" منحكم هذه الأوسمة تقديرا لجهودكم المبدولة لمساعدة الأخرين و تحسين مستوى المنتدى .

بارك الله فيكم


الرجوع الى أعلى الصفحة اذهب الى الأسفل

رد: les endocardite

مُساهمة من طرف mohamed hamdane في الأربعاء 4 يناير 2012 - 8:50



[ [ندعوك للتسجيل في المنتدى أو التعريف بنفسك لمعاينة هذه الصورة]
مرحبا بكم........

<<<<< [ندعوك للتسجيل في المنتدى أو التعريف بنفسك لمعاينة هذا الرابط]

mohamed hamdane
مشرف قسم اللغة الفرنسية
مشرف قسم اللغة الفرنسية

الجنس : ذكر
عدد المساهمات : 1814
تاريخ الميلاد : 16/10/1990
الأختصاص : infirmier de la santé publique
تاريخ التسجيل : 19/04/2011
الأقامة : mostaganem
الأوسمة :

يسر ادارة منتديات "الشفاء" منحكم هذه الأوسمة تقديرا لجهودكم المبدولة لمساعدة الأخرين و تحسين مستوى المنتدى .

بارك الله فيكم


الرجوع الى أعلى الصفحة اذهب الى الأسفل

استعرض الموضوع السابق استعرض الموضوع التالي الرجوع الى أعلى الصفحة


 
صلاحيات هذا المنتدى:
لاتستطيع الرد على المواضيع في هذا المنتدى